![]() ![]() ![]() QC_data/1004.qcup_R2.fastq.gz ILLUMINACLIP:/opt/software/Trimmomatic/0.39-Java-1.8/adapters/NexteraPE-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 The output showed completed successfully with the following message: TrimmomaticPE: Started with arguments: Please see the code below: java -jar /opt/software/Trimmomatic/0.39-Java-1.8/trimmomatic-0.39.jar PE -phred33 1004_R1.fastq.gz 1004_R2.fastq.gz. I specified the library in trimmomatic and Nextera transposase adapters were successfully removed. I came across the same problem of Nextera transposase contamination in my shotgun metagenome sequence. Now, why this is happening? which Nextera transposase sequence is the correct? or am I doing something wrong? However, when running the same command above but changing the sequence to CTGTCTCTTATA, which is the sequence of transposase adaptors according to fastqc tool adapters_list.txt file all is good after running fastqc tool on the file cutadapt -a CTGTCTCTTATA -o Running a very basic cutadapt command line to remove the adapter cutadapt -a TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -o Īfter running the fastqc tool again on the new output file from cutadapt, it seems nothing changed and the contamination still present. Searching for that adapter sequence via google the sequence for at the 3' end to be removed is TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (obtained via illumina adapter sequence-Nature). When running fastqc tool on that file, adapter contamination is present in the form of Nextera Transposase adapters. I am learning about NGS analysis and im currently learning about QCing and removing adaptors. ![]()
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |